View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21608_low_26 (Length: 245)
Name: NF21608_low_26
Description: NF21608
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21608_low_26 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 164; Significance: 9e-88; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 164; E-Value: 9e-88
Query Start/End: Original strand, 68 - 235
Target Start/End: Original strand, 10536405 - 10536572
Alignment:
| Q |
68 |
caacgatgccggacgaaacaagttcgatcgactacgccatggaagcagcatctgggccccacttctccggcctccgtctcgacggcggtcgactctcatc |
167 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
10536405 |
caacgatgccggacgaaacaagttcgatcgactacgccatggaagcagcatctgggccccacttctccggcctccgtctcgacggcggccgactctcatc |
10536504 |
T |
 |
| Q |
168 |
ttccccaaaatcttctttctctatcaattcaatccttaccaaagattctcttctcaatcaaccctttg |
235 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10536505 |
ttccccaaaatcttctttctctatcaattcaatccttaccaaagattctcttctcaatcaaccctttg |
10536572 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University