View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21608_low_28 (Length: 239)
Name: NF21608_low_28
Description: NF21608
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21608_low_28 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 174; Significance: 9e-94; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 174; E-Value: 9e-94
Query Start/End: Original strand, 1 - 197
Target Start/End: Complemental strand, 35042855 - 35042658
Alignment:
| Q |
1 |
tgtctgttttctcaagcggattaggtgtgatccttcaataattttattttgttgggg-atcaaagaattacaacggttcagatttgatgtaaatcaatat |
99 |
Q |
| |
|
|||||||||||||||| |||| ||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35042855 |
tgtctgttttctcaagtggatcaggtgtgatccttcaataattttattttgttgggggatcaaagaattacaacggttcagatttgatgtaaatcaatat |
35042756 |
T |
|
| Q |
100 |
ctatctaagaaacgattaattcgatgagttcaatccaactgttcacttgagttgcaagttactatattatggattaaatgcaaggtaaattacgtact |
197 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
35042755 |
ctatctaagaaacgattaattcgatgagttcaatccaaccgttcacttgagttgcaagttactatattatggattaaatgcaaggtatattacgtact |
35042658 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 23 - 56
Target Start/End: Original strand, 35043227 - 35043260
Alignment:
| Q |
23 |
aggtgtgatccttcaataattttattttgttggg |
56 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
35043227 |
aggtgtgatccttcaataattttattttgttggg |
35043260 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University