View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21608_low_29 (Length: 238)
Name: NF21608_low_29
Description: NF21608
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21608_low_29 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 55; Significance: 1e-22; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 2 - 77
Target Start/End: Complemental strand, 47060817 - 47060742
Alignment:
| Q |
2 |
gaagaaaattggcagaaacnnnnnnngaaactcattttctctgctcaaatttcttgattgagataatatgccaacc |
77 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47060817 |
gaagaaaattggcagaaacaaaaaaagaaactcattttctctgctcaaatttcttgattgagataatatgccaacc |
47060742 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 144 - 214
Target Start/End: Complemental strand, 47060675 - 47060605
Alignment:
| Q |
144 |
aataaatatatgtatcttctttnnnnnnnnntatttgtatctactaatagaaagtggcgagacttcttggc |
214 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47060675 |
aataaatatatgtatcttctttaaaaaaatatatttgtatctactaatagaaagtggcgagacttcttggc |
47060605 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University