View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF21609_low_5 (Length: 235)

Name: NF21609_low_5
Description: NF21609
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF21609_low_5
NF21609_low_5
[»] chr1 (1 HSPs)
chr1 (104-218)||(25246939-25247053)


Alignment Details
Target: chr1 (Bit Score: 115; Significance: 1e-58; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 115; E-Value: 1e-58
Query Start/End: Original strand, 104 - 218
Target Start/End: Original strand, 25246939 - 25247053
Alignment:
104 gacattatttaatatgaaaatgaaagaaaatgacactgaactcttcctcatacactcatttgatatccaaattgaaacaccataattttttattaacctt 203  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
25246939 gacattatttaatatgaaaatgaaagaaaatgacactgaactcttcctcatacactcatttgatatccaaattgaaacaccataattttttattaacctt 25247038  T
204 gcggttgaattatat 218  Q
    |||||||||||||||    
25247039 gcggttgaattatat 25247053  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University