View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2160_high_6 (Length: 264)
Name: NF2160_high_6
Description: NF2160
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2160_high_6 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 219; Significance: 1e-120; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 219; E-Value: 1e-120
Query Start/End: Original strand, 14 - 264
Target Start/End: Complemental strand, 44408271 - 44408021
Alignment:
| Q |
14 |
atataattttcttaaattcttatgatcaaagtaattatggaggaaataaacattaggtattgcgaatgcaggcatagtgcattttcattcaactagtata |
113 |
Q |
| |
|
|||||| ||| |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
44408271 |
atataactttattaaattcttatgatcaaagtaattagggaggaaataaacattaggtattgcgaatgcaggcatagtgcattttcattctactagtata |
44408172 |
T |
 |
| Q |
114 |
aaatatagaatcagttatgctatgtaaggttgcagaacaagatggcgactcagtaagcaccaccgtgaaggtaaaaagcataaaacagaggaaaggaaat |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44408171 |
gaatatagaatcagttatgctatgtaaggttgcagaagaagatggtgactcagtaagcaccaccgtgaaggtaaaaagcataaaacagaggaaaggaaat |
44408072 |
T |
 |
| Q |
214 |
acctgcagtgaggacggactgagtgaggtgaacggaggtcgaagcgaacgt |
264 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
44408071 |
acctgcagtgaggacggactgagtgaggtgaacggaggtcgaagtgaacgt |
44408021 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University