View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF2160_low_7 (Length: 264)

Name: NF2160_low_7
Description: NF2160
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF2160_low_7
NF2160_low_7
[»] chr3 (1 HSPs)
chr3 (14-264)||(44408021-44408271)


Alignment Details
Target: chr3 (Bit Score: 219; Significance: 1e-120; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 219; E-Value: 1e-120
Query Start/End: Original strand, 14 - 264
Target Start/End: Complemental strand, 44408271 - 44408021
Alignment:
14 atataattttcttaaattcttatgatcaaagtaattatggaggaaataaacattaggtattgcgaatgcaggcatagtgcattttcattcaactagtata 113  Q
    |||||| ||| |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||    
44408271 atataactttattaaattcttatgatcaaagtaattagggaggaaataaacattaggtattgcgaatgcaggcatagtgcattttcattctactagtata 44408172  T
114 aaatatagaatcagttatgctatgtaaggttgcagaacaagatggcgactcagtaagcaccaccgtgaaggtaaaaagcataaaacagaggaaaggaaat 213  Q
     |||||||||||||||||||||||||||||||||||| ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||    
44408171 gaatatagaatcagttatgctatgtaaggttgcagaagaagatggtgactcagtaagcaccaccgtgaaggtaaaaagcataaaacagaggaaaggaaat 44408072  T
214 acctgcagtgaggacggactgagtgaggtgaacggaggtcgaagcgaacgt 264  Q
    |||||||||||||||||||||||||||||||||||||||||||| ||||||    
44408071 acctgcagtgaggacggactgagtgaggtgaacggaggtcgaagtgaacgt 44408021  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University