View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21611_high_2 (Length: 478)
Name: NF21611_high_2
Description: NF21611
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21611_high_2 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 397; Significance: 0; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 397; E-Value: 0
Query Start/End: Original strand, 1 - 461
Target Start/End: Original strand, 38008042 - 38008485
Alignment:
| Q |
1 |
ctattaggttattaggtcccaatttattttcatggtgggccaagaaacaaacattgctagaagcagtccaacagtgaggtagaataccacagccttgcct |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
38008042 |
ctattaggttattaggtcccaatttattttcatggtgggccaagaaacaaacattgctagaagcagtccaacagtgaggtagaaaaccacagccttgcct |
38008141 |
T |
|
| Q |
101 |
ctagcaccactgcagaggtcctttggatgcataatttccttacataactgcaggaccccttcattaccaccaattgtttgcggtgacaacttgtgtacac |
200 |
Q |
| |
|
|| ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38008142 |
ctggcaccactgcagaggtcctttggatgcataatt-----------------gaccccttcattaccaccaattgtttgcggtgacaacttgtgtacac |
38008224 |
T |
|
| Q |
201 |
tgtacagtcaattatctctgaacccaattctggcagctgcaaaaacattttctttgtcggagaaaatgttccgaccatgacacgcgggtggcctgcaatc |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38008225 |
tgtacagtcaattatctctgaacccaattctggcagctgcaaaaacattttctttgtcggagaaaatgttccgaccatgacacgcgggtggcctgcaatc |
38008324 |
T |
|
| Q |
301 |
tatatcttaagatcatgtgactgtgacagatgcactcaactcagacaaactgagactgtttgacaaattcagatttcccgctctaccctctgcttgcata |
400 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38008325 |
tatatcttaagatcatgtgactgtgacagatgcactcaactcagacaaactgagactgtttgacaaattcagatttcccgctctaccctctgcttgcata |
38008424 |
T |
|
| Q |
401 |
aaatgtctgtacgtgcatgcatgttctctacaatttgctcaggcccaattgcatatctctg |
461 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38008425 |
aaatgtctgtacgtgcatgcatgttctctacaatttgctcaggcccaattgcatatctctg |
38008485 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University