View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21612_high_19 (Length: 321)
Name: NF21612_high_19
Description: NF21612
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21612_high_19 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 254; Significance: 1e-141; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 254; E-Value: 1e-141
Query Start/End: Original strand, 19 - 320
Target Start/End: Complemental strand, 21828851 - 21828552
Alignment:
| Q |
19 |
atcttgttggaaatatgttgttggaaatgaattttattttattggatatggcagtaacctgtgttcaattcaaccctatggatgaagattatttcattag |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21828851 |
atcttgttggaaatatgttgttggaaatgaattttattttattggatatggcagtaacctgtgttcaattcaaccctatggatgaagattatttcattag |
21828752 |
T |
|
| Q |
119 |
tggttcccttgatgctaaggtcagaatgtggaacatctctgctcgtcttgttgtggattggactgatattcatgaaatggttacagctgtttcttacacc |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
21828751 |
tggttcccttgatgctaaggtcagaatgtggaacatctctgctcgtcttgttgtggattggactgatattcatgaaatggttacagctgtatcttacacc |
21828652 |
T |
|
| Q |
219 |
ccagatggtcaagtatgcannnnnnnnncctctccattatgttttaaaaagtatcaattcttctatttgggtaatatcattttggtatttaaatgtgtga |
318 |
Q |
| |
|
||||||||||||||||||| ||||| | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21828651 |
ccagatggtcaagtatgca-ttttttttcctct-ctttatgttttaaaaagtatcaattcttctatttgggtaatatcattttggtatttaaatgtgtga |
21828554 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University