View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21612_high_26 (Length: 303)
Name: NF21612_high_26
Description: NF21612
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21612_high_26 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 121; Significance: 5e-62; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 121; E-Value: 5e-62
Query Start/End: Original strand, 95 - 215
Target Start/End: Original strand, 38348804 - 38348924
Alignment:
| Q |
95 |
catgccaacctggttttactgtttcttgttgactcttaatttctatgaatagtatatttttatattgtcctttactttggttttcttgacctagattgtt |
194 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38348804 |
catgccaacctggttttactgtttcttgttgactcttaatttctatgaatagtatatttttatattgtcctttactttggttttcttgacctagattgtt |
38348903 |
T |
 |
| Q |
195 |
attttaggtcttggttcattg |
215 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
38348904 |
attttaggtcttggttcattg |
38348924 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University