View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21612_high_35 (Length: 247)
Name: NF21612_high_35
Description: NF21612
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21612_high_35 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 166; Significance: 6e-89; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 166; E-Value: 6e-89
Query Start/End: Original strand, 1 - 230
Target Start/End: Original strand, 11471521 - 11471761
Alignment:
| Q |
1 |
aaatactgaacttgagaaatgaatttgattttgaagaaaaatggatatggaatggttttagagcttttaaaatttagaatgtccgattagaaacttctgc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11471521 |
aaatactgaacttgagaaatgaatttgattttgaagaaaaatggatatggaatggttttagagcttttaaaatttagaatgtccgattagaaacttctgc |
11471620 |
T |
|
| Q |
101 |
aatgcgtatggtggtttttctttttcatatttaattctgga--nnnnnnnnaaataaaaaattgatg---------agatgaagatcttggattaaggat |
189 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||| |||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
11471621 |
aatgcgtatggtagtttttctttttcatatttaattctggattttttttttaaataaaaaattgatgagatgaagaagatgaagatcttggattaaggat |
11471720 |
T |
|
| Q |
190 |
gaagatgaagatttgtacatgacacatcactactaaacaac |
230 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
11471721 |
gaagatgatgatttgtacatgacacatcactactaaacaac |
11471761 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University