View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21612_high_39 (Length: 234)
Name: NF21612_high_39
Description: NF21612
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21612_high_39 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 195; Significance: 1e-106; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 24 - 218
Target Start/End: Original strand, 55605066 - 55605260
Alignment:
| Q |
24 |
ggtggtgatttcagtgatgataatttatggctttgtgagaagttggtgacacttttattagataaatgggattgtttattagaagaaatgccacatgttt |
123 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55605066 |
ggtggtgatttcagtgatgataatttatggctttgtgagaagttggtgacacttttattagataaatgggattgtttattagaagaaatgccacatgttt |
55605165 |
T |
 |
| Q |
124 |
tgtgtagtggtttgtacgtgtttcttcgagttttggctgatcattgtagggtgaatggtgaaaagtttgagtctttgaagcgtttggaggttcat |
218 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55605166 |
tgtgtagtggtttgtacgtgtttcttcgagttttggctgatcattgtagggtgaatggtgaaaagtttgagtctttgaagcgtttggaggttcat |
55605260 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 30 - 73
Target Start/End: Original strand, 44800991 - 44801034
Alignment:
| Q |
30 |
gatttcagtgatgataatttatggctttgtgagaagttggtgac |
73 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||| ||||||| |
|
|
| T |
44800991 |
gatttcagtgatgataatttgtggctttgtgagaaaatggtgac |
44801034 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University