View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21612_high_43 (Length: 204)
Name: NF21612_high_43
Description: NF21612
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21612_high_43 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 126; Significance: 4e-65; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 126; E-Value: 4e-65
Query Start/End: Original strand, 1 - 138
Target Start/End: Original strand, 52761232 - 52761369
Alignment:
| Q |
1 |
acttgaatctaattgtcttctctaaacacaaacaattaaatatcaacagcttagtgatggtttaggtgaacattaaaaactataccttctctaaaacaag |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
52761232 |
acttgaatctaattgtcttctctaaacacaaacaattaaatatcaacagcttggtgatggtttaggtgaactttaaaaactataccttctctaaaacaag |
52761331 |
T |
 |
| Q |
101 |
cttgtactctataagttcattataagtgtgcagcaact |
138 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
52761332 |
cttgtactctataagttcattataagtgtgctgcaact |
52761369 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 59; E-Value: 3e-25
Query Start/End: Original strand, 128 - 186
Target Start/End: Complemental strand, 52761168 - 52761110
Alignment:
| Q |
128 |
gtgcagcaactcgccagagagagcttgaagttcaacaaccatctgttgaagggtctatt |
186 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52761168 |
gtgcagcaactcgccagagagagcttgaagttcaacaaccatctgttgaagggtctatt |
52761110 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University