View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21612_low_30 (Length: 276)
Name: NF21612_low_30
Description: NF21612
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21612_low_30 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 101; Significance: 4e-50; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 101; E-Value: 4e-50
Query Start/End: Original strand, 1 - 105
Target Start/End: Complemental strand, 11471545 - 11471441
Alignment:
| Q |
1 |
aattcatttctcaagttcagtatttcacaaaatccaattcagaaaaatgctttaatgtaaaatggattcggttagaacattgatatagtacaaatgtaaa |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11471545 |
aattcatttctcaagttcagtatttcacaaaatccaattcagaaaaatgctttcatgtaaaatggattcggttagaacattgatatagtacaaatgtaaa |
11471446 |
T |
|
| Q |
101 |
attta |
105 |
Q |
| |
|
||||| |
|
|
| T |
11471445 |
attta |
11471441 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 99; E-Value: 6e-49
Query Start/End: Original strand, 97 - 259
Target Start/End: Original strand, 11471588 - 11471761
Alignment:
| Q |
97 |
taaaatttagaatgtccgattagaaacttctgcaatgcgtatggtggtttttctttttcatatttaattctgga--nnnnnnnnaaataaaaaattgatg |
194 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
11471588 |
taaaatttagaatgtccgattagaaacttctgcaatgcgtatggtagtttttctttttcatatttaattctggattttttttttaaataaaaaattgatg |
11471687 |
T |
|
| Q |
195 |
---------agatgaagatcttggattaaggatgaagatgaagatttgtacatgacacatcactactaaacaac |
259 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
11471688 |
agatgaagaagatgaagatcttggattaaggatgaagatgatgatttgtacatgacacatcactactaaacaac |
11471761 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University