View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21612_low_35 (Length: 260)
Name: NF21612_low_35
Description: NF21612
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21612_low_35 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 178; Significance: 4e-96; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 178; E-Value: 4e-96
Query Start/End: Original strand, 1 - 252
Target Start/End: Complemental strand, 4459639 - 4459388
Alignment:
| Q |
1 |
ttagtgtttgtatgtggtgacctcccatatgagtccatctatgcc--cgcaaactcttgcagattttaggttgttttcaatattgggtggtttcgatttt |
98 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||| | |||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
4459639 |
ttagtgtttgaatgtggtgacctcccatatgagtccatctatgtcaccgcaaactcttgcagattttaggttgttttcaattttgggtggtttcgatttt |
4459540 |
T |
|
| Q |
99 |
gaattgttttcgagttgtgtcccttttcgatatatannnnnnnagttagcacttcatctgtcgacggccttaaggatttttcgtctgggtttttgggcta |
198 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
4459539 |
gaattgttttcgagttgtgtcccttttcgatatatatattt----ttagcacttcatctgtcgactgccttaaggatttttcgtctgggtttttgggcta |
4459444 |
T |
|
| Q |
199 |
gttatggttttcttcagtggaccaggagtag--atgggtgccttttgatgatgtcc |
252 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||| ||||| ||||||||| |
|
|
| T |
4459443 |
gttatggttttcttcagtggaccaggagtagatatgggtgtctttttatgatgtcc |
4459388 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University