View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21612_low_37 (Length: 238)
Name: NF21612_low_37
Description: NF21612
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21612_low_37 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 134; Significance: 7e-70; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 134; E-Value: 7e-70
Query Start/End: Original strand, 24 - 189
Target Start/End: Original strand, 15449863 - 15450028
Alignment:
| Q |
24 |
gtaagttactaggttgcttgtgaggtagcggaatgctagggtttgggtcttagagggttagatatcatgtcataatgattattggatcttttaatattag |
123 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||| |||||| ||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15449863 |
gtaagttactgggttgcttgtgaggtagcggaatgctatggtttgagtcttagggggttagatatcatgtcataatgattattggatcttttaatattag |
15449962 |
T |
 |
| Q |
124 |
aggtgtacgtgggagagtgaaaagaggcaaggtacgagagtttaaaggtaataaccatcttgattt |
189 |
Q |
| |
|
|||||||||| |||||||||||||||||||| | ||||||||||||| |||||||||||||||||| |
|
|
| T |
15449963 |
aggtgtacgtcggagagtgaaaagaggcaagctgcgagagtttaaagctaataaccatcttgattt |
15450028 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University