View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21612_low_41 (Length: 223)
Name: NF21612_low_41
Description: NF21612
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21612_low_41 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 153; Significance: 3e-81; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 153; E-Value: 3e-81
Query Start/End: Original strand, 1 - 204
Target Start/End: Original strand, 4459615 - 4459826
Alignment:
| Q |
1 |
ggaggtcaccacatacaaacactaatagaagataccaaaaatagccacacaaccccattcaacaaaataacacccaatacctaccccaacacataaacct |
100 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
4459615 |
ggaggtcaccacattcaaacactaatagaagataccaaaaatagccacacaaccccattcaacaaaataacacccaataccaaccccaacacataaacct |
4459714 |
T |
 |
| Q |
101 |
ctcgaaaaatgaatcacaatcataccccaaacatctccaaactatttacttcatccatctaagtatgaga---------tcaatgtcaagtaaacttcaa |
191 |
Q |
| |
|
| |||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |||||||| |||||||| |||||||||||| |
|
|
| T |
4459715 |
cccgaaaaatgaatcacaatcata-cccaaacatctccaaactatttacttcatccatctatgtatgagatctaaatcctcaatgtcgagtaaacttcaa |
4459813 |
T |
 |
| Q |
192 |
cagattgcaaact |
204 |
Q |
| |
|
||||||||||||| |
|
|
| T |
4459814 |
cagattgcaaact |
4459826 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University