View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21612_low_44 (Length: 213)
Name: NF21612_low_44
Description: NF21612
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21612_low_44 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 136; Significance: 4e-71; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 136; E-Value: 4e-71
Query Start/End: Original strand, 20 - 209
Target Start/End: Complemental strand, 28730192 - 28730008
Alignment:
| Q |
20 |
ttcacactattatccatatatactctatgttgcttaactagttcgttaataaaacaatttgtggatttagtctttacagattttcttgagagattatctt |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
28730192 |
ttcacactattatccatatatactctatgttgcttaactagttcgttaataa-------tgtggatttagtctttacagattttcttgaga--ttatctt |
28730102 |
T |
 |
| Q |
120 |
gtgtatgatgtatcaattcatggtttcttacaatttgtgtatga----tttagtctttggggaagtatctgttttcacaggcttatgacttttg |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
28730101 |
gtgtatgatgtatcaattcatggtttcttacaatttgtgtatgatttatttagtctttggggaagtatctgttttcacaggcttatgaattttg |
28730008 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 54; Significance: 3e-22; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 54; E-Value: 3e-22
Query Start/End: Original strand, 20 - 108
Target Start/End: Complemental strand, 38120615 - 38120529
Alignment:
| Q |
20 |
ttcacactattatccatatatactctatgttgcttaactagttcgttaataaaacaatttgtggatttagtctttacagattttcttga |
108 |
Q |
| |
|
|||||||||||||||| || ||| ||||||||||| |||||| | |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38120615 |
ttcacactattatccaactacact--atgttgcttaaatagttcttcaataaaacaatttgtggatttagtctttacagattttcttga |
38120529 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University