View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21614_high_19 (Length: 433)
Name: NF21614_high_19
Description: NF21614
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21614_high_19 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 339; Significance: 0; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 339; E-Value: 0
Query Start/End: Original strand, 1 - 351
Target Start/End: Original strand, 40772016 - 40772366
Alignment:
| Q |
1 |
cactgcttgaagttccttcattccccggttccttttcttcaaggaagtaggaaaactctcgaggttcagattcagattgaggtagtggagttagggtgtc |
100 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40772016 |
cactgcttgaagttccttcgttccccggttccttttcttcaaggaagtaggaaaactctcgaggttcagattcagattgaggtagtggagttagggtgtc |
40772115 |
T |
|
| Q |
101 |
aactaactctaattgtttgtttttcgattcttccataatgtatctctagggttacagctttagaatttctattaaacttagaatatgtttgtgatcacac |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40772116 |
aactaactctaattgtttgtttttcgattcttccataatgtatttctagggttacagcattagaatttctattaaacttagaatatgtttgtgatcacac |
40772215 |
T |
|
| Q |
201 |
ttaaatagagatgaaattgttgtttttgcttacagcaagccaagctgtttggtcaccactccaatggcctcaaaggtttatgtaagagacattgtgaaga |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40772216 |
ttaaatagagatgaaattgttgtttttgcttacagcaagccaagctgtttggtcaccactccaatggcctcaaaggtttatgtaagagacattgtgaaga |
40772315 |
T |
|
| Q |
301 |
ctcaaacggggtccactaatagacagttatgcggatattcactgctttgtc |
351 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40772316 |
ctcaaacggggtccactaatagacagttatgcggatattcactgctttgtc |
40772366 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University