View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21614_high_24 (Length: 355)
Name: NF21614_high_24
Description: NF21614
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21614_high_24 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 302; Significance: 1e-170; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 302; E-Value: 1e-170
Query Start/End: Original strand, 4 - 345
Target Start/End: Original strand, 34872277 - 34872618
Alignment:
| Q |
4 |
ttcccaggtctggaataaccttcagctttagatcactgtggcaaagggtcgagtgggggccatatcgatcaggatcggaccgcacgttcaacagctggag |
103 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||| |||||| ||||||||||||||||||||||||||||||||||| |||||||||||| ||||| |
|
|
| T |
34872277 |
ttcccaggtcttgaataaccttcagctttagatcactgcggcaaatggtcgagtgggggccatatcgatcaggatcggaccacacgttcaacagttggag |
34872376 |
T |
|
| Q |
104 |
cagatcctctccctcagaccgaagaggcacaactttgacgggcacattcttccctttgtcaacaggctccaccctattccccttgagagagttgctcgcc |
203 |
Q |
| |
|
|| ||||||||||| |||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
34872377 |
caaatcctctccctgagactgaagaggcacaactttgacgggcacattcttccctttgtcaacaggctccaccctattccccttgagagagttgctcacc |
34872476 |
T |
|
| Q |
204 |
tctacctccatattgtcgtcatcggccacctccactacctgctgagaagaagagtccagtcctgccccagcaatcatggtgttgacgttgtggatgtcta |
303 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
34872477 |
tctacctccatattgtcgtcatcggccacctccactacctgctgagaagaagagtccagtcctgccccagcaatcatggtgttgacgtggtggatgtcta |
34872576 |
T |
|
| Q |
304 |
tcctcctaccgccgcctcggctggccaacttcctgctagatt |
345 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34872577 |
tcctcctaccgccgcctcggctggccaacttcctgctagatt |
34872618 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University