View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21614_high_29 (Length: 320)
Name: NF21614_high_29
Description: NF21614
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21614_high_29 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 264; Significance: 1e-147; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 264; E-Value: 1e-147
Query Start/End: Original strand, 13 - 304
Target Start/End: Complemental strand, 45838833 - 45838535
Alignment:
| Q |
13 |
aatatggggcctaaaattaagattatgaaatgtgagaatagattagagatagcttcctttttaggggacttgtttggtaacccacgaattccgtgtcaac |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45838833 |
aatatggggcctaaaattaagattatgaaatgtgagaatagattagagatagcttcctttttaggggacttgtttggtaacccacgaattccgtgtcaac |
45838734 |
T |
 |
| Q |
113 |
ttggttgtgttgccgctgaaagtgatgcatgcatattgcatata-tagaaccaaagaaaactaaaccacaaacatgcttttctttctttttaggcacaca |
211 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45838733 |
ttggttgtgttgccgctgaaagtgatgcgtgcatattgcatatattagaaccaaagaaaactaaaccacaaacatgcttttctttctttttaggcacaca |
45838634 |
T |
 |
| Q |
212 |
tttcttggctggctggcctttccattttcaagtgcaagcttttagcaatacttac------tagtagtgcatattgccctttccataaagtcacctact |
304 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45838633 |
tttcttggctggctggcctttccattttcaagtgcaagcttttagcaatacttactagtagtagtagtgcatattgccctttccataaagtcacctact |
45838535 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University