View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21614_high_43 (Length: 237)
Name: NF21614_high_43
Description: NF21614
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21614_high_43 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 205; Significance: 1e-112; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 13 - 221
Target Start/End: Original strand, 38106578 - 38106786
Alignment:
| Q |
13 |
agagagatctgtggcgagaaacggaaatagcggggagagatttatcagggaaagagattgtacacgtggtgttgttgtgtaagaatgtgttggccatatc |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38106578 |
agagagatctgtggcgagaaacggaaatagcggggagagatttatcagggaaagagattgtacacgtggtgttgttgtgtaagaatgtgttggccatatc |
38106677 |
T |
 |
| Q |
113 |
ggataaatttggaaagtatgtaactgaatgtgaatgaggattacgaagaagaaagaaacaaaacgcagcagaatggattattggtaagtggtgtgtgaga |
212 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
38106678 |
ggataaatttggaaagtatgtaactgaatgtgaatgaggattacgaagaagaaagaaacaaaacgcagcagaatggattattggtaagttgtgtgtgaga |
38106777 |
T |
 |
| Q |
213 |
agaacaaaa |
221 |
Q |
| |
|
||||||||| |
|
|
| T |
38106778 |
agaacaaaa |
38106786 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University