View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21614_high_44 (Length: 236)
Name: NF21614_high_44
Description: NF21614
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21614_high_44 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 65; Significance: 1e-28; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 32 - 108
Target Start/End: Complemental strand, 48711285 - 48711209
Alignment:
| Q |
32 |
aacgataggagccaggcaggaaaaggaagttacagaaattgaaagagccaaaaaatacaaacagaacagaaactata |
108 |
Q |
| |
|
|||||||||||||| ||||||||||||| ||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48711285 |
aacgataggagccaagcaggaaaaggaaattacaaaaattgaaagagccaaaaaatacaaacagaacagaaactata |
48711209 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 137 - 215
Target Start/End: Complemental strand, 48711097 - 48711016
Alignment:
| Q |
137 |
ttgttgaagagatgaatttggcgaaatctatttttctgggtttatgggttgt---tgttaccaaatgatcctattttgatgt |
215 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||| |||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
48711097 |
ttgttgaagagatgaattcggcgaaatctatttttctcggtttatgggttgttgttgttaccaaatgatcctattttgatgt |
48711016 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University