View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21614_low_23 (Length: 394)
Name: NF21614_low_23
Description: NF21614
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21614_low_23 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 274; Significance: 1e-153; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 274; E-Value: 1e-153
Query Start/End: Original strand, 62 - 394
Target Start/End: Complemental strand, 43587711 - 43587373
Alignment:
| Q |
62 |
atatgcaaatttagtttaaaactactagtgcagattaggctgttgatgctgtttgttgagaggtgtttatgtctgctgtccttttgattgtaacattttc |
161 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||| |||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
43587711 |
atatgcaaatttagtttaaaactactagtgcggattaggctgttgatggtgtttgttgagaggtgtttatgtctgctgtccttctgattgtaacattttc |
43587612 |
T |
 |
| Q |
162 |
ttgattaaattgtggattttgtatgcggtttctggttgtcgtctgctatcgagggctgttgctgcattttttaagcttcctgttatgttttttgccttct |
261 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
43587611 |
ttgattaaattgtggattttgtatgcggtttctggttttcgtctgctatcgagggctgttgctgcgttttttaagcttcctgttatgttttttgccttct |
43587512 |
T |
 |
| Q |
262 |
ggtgaggattttttagcttttcttggctgctgatttggttgcgtgtgtgtagagggctggtgcttagtccttgtttttc-------gtttaattttggtt |
354 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |||||||||| |||||||||||||| |
|
|
| T |
43587511 |
ggtgaggat-ttttagcttttcttggctgctgatttggttgcgtgtgtgtagagggctgatgcttagttcttgtttttcggtttttgtttaattttggtt |
43587413 |
T |
 |
| Q |
355 |
taatttttcacattgctagatcattggtggatttctacca |
394 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
43587412 |
taatttttcacattgctagatcattggtggatttgtacca |
43587373 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University