View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21614_low_41 (Length: 247)
Name: NF21614_low_41
Description: NF21614
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21614_low_41 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 217; Significance: 1e-119; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 217; E-Value: 1e-119
Query Start/End: Original strand, 1 - 229
Target Start/End: Complemental strand, 5112243 - 5112015
Alignment:
| Q |
1 |
aattcaatgtggttcatcatgcaagaggattagtggtgaggtaacattgcaactttctgattcttcaaatataccaatttcttcaaatggattttcttgt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |||||| |
|
|
| T |
5112243 |
aattcaatgtggttcatcatgcaagaggattagtggtgaggtaacattgcaactttctgattcttcaaatataccaatttcttcaaatggtttctcttgt |
5112144 |
T |
|
| Q |
101 |
tgggtgaggattgaatgggaaaataatggacagaagaaaaattgtgtgaatgctttttgtgatgttatcaagttgtgttgtgatcaatcaagggactatg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
5112143 |
tgggtgaggattgaatgggaaaataatggacagaagaaaaattgtgtgaatgctttttgtgatgttgtcaagttgtgttgtgatcaatcaagggactatg |
5112044 |
T |
|
| Q |
201 |
ttttcacttggaggtttcatactcgttct |
229 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
5112043 |
ttttcacttggaggtttcatactcgttct |
5112015 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University