View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21614_low_42 (Length: 243)
Name: NF21614_low_42
Description: NF21614
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21614_low_42 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 100; Significance: 1e-49; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 100; E-Value: 1e-49
Query Start/End: Original strand, 4 - 111
Target Start/End: Original strand, 47965171 - 47965278
Alignment:
| Q |
4 |
gggatcatcatcaagctgagttttgagaacaacataagcagaattcgacatcacttgtcggctgataacaaattgcaagagtctaaacaaaacaccttac |
103 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
47965171 |
gggatcatcatcaagctgagttttgagaacaacataaccagaattcgacatcacttgtcggctgataacaaattgcaagagtctaaacaaaacacctcac |
47965270 |
T |
 |
| Q |
104 |
cctctcta |
111 |
Q |
| |
|
|||||||| |
|
|
| T |
47965271 |
cctctcta |
47965278 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University