View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF21614_low_46 (Length: 236)

Name: NF21614_low_46
Description: NF21614
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF21614_low_46
NF21614_low_46
[»] chr4 (2 HSPs)
chr4 (32-108)||(48711209-48711285)
chr4 (137-215)||(48711016-48711097)


Alignment Details
Target: chr4 (Bit Score: 65; Significance: 1e-28; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 32 - 108
Target Start/End: Complemental strand, 48711285 - 48711209
Alignment:
32 aacgataggagccaggcaggaaaaggaagttacagaaattgaaagagccaaaaaatacaaacagaacagaaactata 108  Q
    |||||||||||||| ||||||||||||| ||||| ||||||||||||||||||||||||||||||||||||||||||    
48711285 aacgataggagccaagcaggaaaaggaaattacaaaaattgaaagagccaaaaaatacaaacagaacagaaactata 48711209  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 137 - 215
Target Start/End: Complemental strand, 48711097 - 48711016
Alignment:
137 ttgttgaagagatgaatttggcgaaatctatttttctgggtttatgggttgt---tgttaccaaatgatcctattttgatgt 215  Q
    |||||||||||||||||| |||||||||||||||||| ||||||||||||||   |||||||||||||||||||||||||||    
48711097 ttgttgaagagatgaattcggcgaaatctatttttctcggtttatgggttgttgttgttaccaaatgatcctattttgatgt 48711016  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University