View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21614_low_49 (Length: 203)
Name: NF21614_low_49
Description: NF21614
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21614_low_49 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 155; Significance: 2e-82; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 155; E-Value: 2e-82
Query Start/End: Original strand, 1 - 187
Target Start/End: Complemental strand, 2563732 - 2563552
Alignment:
| Q |
1 |
attactgactgttattagatgtttgtttaactaattgatcaattattaataaactatataataatacttgaattgctcacagattttgaatgtcttaata |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
2563732 |
attactgactgttattagatgtttgtttaactaattgatcaatta---ataaactatataata---cttgaattgctcacagattttgaatgtcttaata |
2563639 |
T |
 |
| Q |
101 |
gcttcaacgaatatttggtatcttttttcttaaagacaattgaagcagctgaaagtgcagcagcagcctcagctgcagcctcagttc |
187 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2563638 |
gcttcgacgaatatttggtatcttttttcttaaagacaattgaagcagctgaaagtgcagcagcagcctcagctgcagcctcagttc |
2563552 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 73; E-Value: 1e-33
Query Start/End: Original strand, 67 - 187
Target Start/End: Complemental strand, 2573445 - 2573325
Alignment:
| Q |
67 |
cttgaattgctcacagattttgaatgtcttaatagcttcaacgaatatttggtatcttttttcttaaagacaattgaagcagctgaaagtgcagcagcag |
166 |
Q |
| |
|
||||||||||| ||||||||||| || ||||||||||| | ||||| ||| ||||| ||||||||||||||||||||||||| ||||| || ||||||| |
|
|
| T |
2573445 |
cttgaattgcttacagattttgactggcttaatagcttggatgaataattgatatctgttttcttaaagacaattgaagcagcagaaagagcggcagcag |
2573346 |
T |
 |
| Q |
167 |
cctcagctgcagcctcagttc |
187 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
2573345 |
cctcagctgcagcctcagttc |
2573325 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University