View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21615_high_12 (Length: 369)
Name: NF21615_high_12
Description: NF21615
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21615_high_12 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 78; Significance: 3e-36; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 78; E-Value: 3e-36
Query Start/End: Original strand, 1 - 78
Target Start/End: Original strand, 42716997 - 42717074
Alignment:
| Q |
1 |
tcgctaacatgattgatcgtgctcttgaaagagagtttcccgaaaatgaacagaacgaaggtttctagatctatcttc |
78 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42716997 |
tcgctaacatgattgatcgtgctcttgaaagagagtttcccgaaaatgaacagaacgaaggtttctagatctatcttc |
42717074 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 71 - 115
Target Start/End: Complemental strand, 42716994 - 42716950
Alignment:
| Q |
71 |
ctatcttcattggatcccgcaagcgaagcattgccaacggcggtt |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42716994 |
ctatcttcattggatcccgcaagcgaagcattgccaacggcggtt |
42716950 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 38; Significance: 0.000000000002; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 328 - 369
Target Start/End: Complemental strand, 34685107 - 34685066
Alignment:
| Q |
328 |
ttcaaagccgaagaaatgggaaatgttttgtttgattggaaa |
369 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
34685107 |
ttcaaagccgaagaaatgtgaaatgttttgtttgattggaaa |
34685066 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University