View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21615_high_18 (Length: 313)
Name: NF21615_high_18
Description: NF21615
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21615_high_18 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 232; Significance: 1e-128; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 232; E-Value: 1e-128
Query Start/End: Original strand, 20 - 303
Target Start/End: Complemental strand, 41685863 - 41685583
Alignment:
| Q |
20 |
gaatgtactcagctctcccttatgcaattgctcaggtaaacgaagctgatcctttcacacacacgaaaacaggaaggnnnnnnnnnnnnncaccagttaa |
119 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
41685863 |
gaatgtactcagctctcccttatgcaattgctcaggtaaacgaagctgatcctttcacacacacgaaaacaggaaggaaaaaaaaaa---caccagttaa |
41685767 |
T |
|
| Q |
120 |
ttgaatttccaataactaagcaaacttatgaaatctacaagcattgacttgcaggtagcaatagaatgtatatacgttgcaatccaaacactagcgtata |
219 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41685766 |
ttgaatttccaataactaagcaaacttacgaaatctacaaggattgacttgcaggtagcaatagaatgtatatacgttgcaatccaaacactagcgtata |
41685667 |
T |
|
| Q |
220 |
cccttatcctttactcaatgatggggttcccttggcaagctgacaagttcatctggttctactactttatattcatgtcctttg |
303 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41685666 |
cccttatcctttactcaatgatggggttcccttggcaagctgacaagttcatctggttctactactttatattcatgtcctttg |
41685583 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University