View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF21615_high_24 (Length: 278)

Name: NF21615_high_24
Description: NF21615
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF21615_high_24
NF21615_high_24
[»] chr1 (2 HSPs)
chr1 (8-260)||(6270566-6270818)
chr1 (69-129)||(6261600-6261660)


Alignment Details
Target: chr1 (Bit Score: 245; Significance: 1e-136; HSPs: 2)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 245; E-Value: 1e-136
Query Start/End: Original strand, 8 - 260
Target Start/End: Original strand, 6270566 - 6270818
Alignment:
8 gagcagagatgacggagcggtttgaccggattgaggagtcgaaccggaggatggagcggttttttggagggatgaagattggcgttggtggtgttgggtg 107  Q
    |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
6270566 gagccgagatgacggagcggtttgaccggattgaggagtcgaaccggaggatggagcggttttttggagggatgaagattggcgttggtggtgttgggtg 6270665  T
108 ggttgaggaagctgtgaggtctagtgaggaagatgagggtagtttggggaatttggatttgagttttggtttggagtttgggaagaataaggttatggaa 207  Q
    |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
6270666 ggttgagggagctgtgaggtctagtgaggaagatgagggtagtttggggaatttggatttgagttttggtttggagtttgggaagaataaggttatggaa 6270765  T
208 atggttgttggaaggaaagatttttgtcttgttggaatttctgggattggtgg 260  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||    
6270766 atggttgttggaaggaaagatttttgtcttgttggaatttctgggattggtgg 6270818  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 69 - 129
Target Start/End: Original strand, 6261600 - 6261660
Alignment:
69 ttttggagggatgaagattggcgttggtggtgttgggtgggttgaggaagctgtgaggtct 129  Q
    |||||| | ||||||||||||||| || ||||  ||||||||  |||||||||||||||||    
6261600 ttttggtgagatgaagattggcgtgggaggtggagggtgggtgcaggaagctgtgaggtct 6261660  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University