View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21615_high_24 (Length: 278)
Name: NF21615_high_24
Description: NF21615
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21615_high_24 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 245; Significance: 1e-136; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 245; E-Value: 1e-136
Query Start/End: Original strand, 8 - 260
Target Start/End: Original strand, 6270566 - 6270818
Alignment:
| Q |
8 |
gagcagagatgacggagcggtttgaccggattgaggagtcgaaccggaggatggagcggttttttggagggatgaagattggcgttggtggtgttgggtg |
107 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6270566 |
gagccgagatgacggagcggtttgaccggattgaggagtcgaaccggaggatggagcggttttttggagggatgaagattggcgttggtggtgttgggtg |
6270665 |
T |
 |
| Q |
108 |
ggttgaggaagctgtgaggtctagtgaggaagatgagggtagtttggggaatttggatttgagttttggtttggagtttgggaagaataaggttatggaa |
207 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6270666 |
ggttgagggagctgtgaggtctagtgaggaagatgagggtagtttggggaatttggatttgagttttggtttggagtttgggaagaataaggttatggaa |
6270765 |
T |
 |
| Q |
208 |
atggttgttggaaggaaagatttttgtcttgttggaatttctgggattggtgg |
260 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6270766 |
atggttgttggaaggaaagatttttgtcttgttggaatttctgggattggtgg |
6270818 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 69 - 129
Target Start/End: Original strand, 6261600 - 6261660
Alignment:
| Q |
69 |
ttttggagggatgaagattggcgttggtggtgttgggtgggttgaggaagctgtgaggtct |
129 |
Q |
| |
|
|||||| | ||||||||||||||| || |||| |||||||| ||||||||||||||||| |
|
|
| T |
6261600 |
ttttggtgagatgaagattggcgtgggaggtggagggtgggtgcaggaagctgtgaggtct |
6261660 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University