View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21615_high_32 (Length: 207)
Name: NF21615_high_32
Description: NF21615
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21615_high_32 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 115; Significance: 1e-58; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 115; E-Value: 1e-58
Query Start/End: Original strand, 47 - 186
Target Start/End: Original strand, 31079461 - 31079604
Alignment:
| Q |
47 |
cttaaaaattaggcgaggaactcgtgagatgagtagaagatttaaattgttggatgtgtgtgcaacgtgattttgaagcaatcagattctttatcgttac |
146 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31079461 |
cttaaaaattaggcgaggaactcgtgagatgagtagaagatttaaattgttggatgtgtgggcaacgtgattttgaagcaatcagattctttatcgttac |
31079560 |
T |
 |
| Q |
147 |
aat----gttgtcgcgaatcagattacaaagttgttcgcattcg |
186 |
Q |
| |
|
||| |||||||| |||||| ||||||||||||||||||||| |
|
|
| T |
31079561 |
aatatacgttgtcgcaaatcaggttacaaagttgttcgcattcg |
31079604 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University