View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21615_low_17 (Length: 352)
Name: NF21615_low_17
Description: NF21615
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21615_low_17 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 77; Significance: 1e-35; HSPs: 4)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 77; E-Value: 1e-35
Query Start/End: Original strand, 151 - 227
Target Start/End: Original strand, 21354375 - 21354451
Alignment:
| Q |
151 |
tcatttcgtgctacttggtcttccatccatatgcttctgcccttaaaattttaatctttatgcttgtgtgtcttatg |
227 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21354375 |
tcatttcgtgctacttggtcttccatccatatgcttctgcccttaaaattttaatctttatgcttgtgtgtcttatg |
21354451 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 70; E-Value: 2e-31
Query Start/End: Original strand, 150 - 227
Target Start/End: Complemental strand, 29406 - 29329
Alignment:
| Q |
150 |
ttcatttcgtgctacttggtcttccatccatatgcttctgcccttaaaattttaatctttatgcttgtgtgtcttatg |
227 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
29406 |
ttcatttcgagctacttggtcttccatccatatgcttctgcccttaaaattttcatctttatgcttgtgtgtcttatg |
29329 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 66; E-Value: 4e-29
Query Start/End: Original strand, 150 - 227
Target Start/End: Complemental strand, 21365576 - 21365499
Alignment:
| Q |
150 |
ttcatttcgtgctacttggtcttccatccatatgcttctgcccttaaaattttaatctttatgcttgtgtgtcttatg |
227 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| ||||| |
|
|
| T |
21365576 |
ttcatttcgagctacttggtcttccatccatatgcttctgcctttaaaattttaatctttatgcttgtgtgttttatg |
21365499 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #4
Raw Score: 62; E-Value: 1e-26
Query Start/End: Original strand, 150 - 227
Target Start/End: Complemental strand, 21351797 - 21351720
Alignment:
| Q |
150 |
ttcatttcgtgctacttggtcttccatccatatgcttctgcccttaaaattttaatctttatgcttgtgtgtcttatg |
227 |
Q |
| |
|
||||||||| |||||||||||||||||||||| |||||||||||||||||||||||||| ||||||| |||||||||| |
|
|
| T |
21351797 |
ttcatttcgagctacttggtcttccatccatacgcttctgcccttaaaattttaatcttaatgcttgcgtgtcttatg |
21351720 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 42; Significance: 0.000000000000008; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 166 - 227
Target Start/End: Complemental strand, 15298759 - 15298698
Alignment:
| Q |
166 |
tggtcttccatccatatgcttctgcccttaaaattttaatctttatgcttgtgtgtcttatg |
227 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||| ||||||||| | |||||||||||| |
|
|
| T |
15298759 |
tggtcttccatctgtatgcttctgcccttaaaattttcatctttatgttcgtgtgtcttatg |
15298698 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 29; Significance: 0.0000005; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 53 - 81
Target Start/End: Complemental strand, 45745802 - 45745774
Alignment:
| Q |
53 |
cttataatttgggacggagggagtattgt |
81 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
45745802 |
cttataatttgggacggagggagtattgt |
45745774 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 29; Significance: 0.0000005; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 52 - 80
Target Start/End: Original strand, 50665337 - 50665365
Alignment:
| Q |
52 |
gcttataatttgggacggagggagtattg |
80 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
50665337 |
gcttataatttgggacggagggagtattg |
50665365 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University