View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21615_low_30 (Length: 237)
Name: NF21615_low_30
Description: NF21615
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21615_low_30 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 157; Significance: 1e-83; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 157; E-Value: 1e-83
Query Start/End: Original strand, 1 - 157
Target Start/End: Complemental strand, 9449791 - 9449635
Alignment:
| Q |
1 |
gacacgcccctaaaatcattagcaagagccttaaccatcggttgagaggggttattataataaaagcctatggacagagtaagctcacatcccatattgg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9449791 |
gacacgcccctaaaatcattagcaagagccttaaccatcggttgagaggggttattataataaaagcctatggacagagtaagctcacatcccatattgg |
9449692 |
T |
|
| Q |
101 |
caagcatttctgcacatatattagtttcccgcacataatttcgcaacaaatttggtg |
157 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9449691 |
caagcatttctgcacatatattagtttcccgcacataatttcgcaacaaatttggtg |
9449635 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 166 - 224
Target Start/End: Complemental strand, 9446796 - 9446738
Alignment:
| Q |
166 |
caatttttcaatgactctgagtttaagaagcattttttccattgtaacgttctaattga |
224 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9446796 |
caatttttcaatgactctgagtttaagaagcattttttccattgtaacgttctaattga |
9446738 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University