View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21615_low_33 (Length: 208)
Name: NF21615_low_33
Description: NF21615
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21615_low_33 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 149; Significance: 7e-79; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 149; E-Value: 7e-79
Query Start/End: Original strand, 16 - 188
Target Start/End: Complemental strand, 41288654 - 41288487
Alignment:
| Q |
16 |
aagggtatgaagaaaaatgatgaaagtctctcctttctttcttaggtactctatagtaatgatttagtcctagagcttaatcttcttctatcttttcctt |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41288654 |
aagggtatgaagaaaaatgatgaaagtctctcctttctttcttaagtactctatagtaatgatttagtcctagagcttaatcttcttctatcttttcctt |
41288555 |
T |
 |
| Q |
116 |
tctcttcaatgtaatgtaacaagaacactaaatctaattgatctttgactttcgatttgatctttgacttaat |
188 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41288554 |
tctcttcaatgtaat-----aagaacactaaatctaattgatctttgactttcgatttgatctttgacttaat |
41288487 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 35; Significance: 0.00000000007; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 21 - 67
Target Start/End: Original strand, 23406633 - 23406679
Alignment:
| Q |
21 |
tatgaagaaaaatgatgaaagtctctcctttctttcttaggtactct |
67 |
Q |
| |
|
||||||||||||||||||||||||||||| ||| |||| |||||||| |
|
|
| T |
23406633 |
tatgaagaaaaatgatgaaagtctctcctctctctctttggtactct |
23406679 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 34; Significance: 0.0000000003; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 22 - 67
Target Start/End: Complemental strand, 29346879 - 29346834
Alignment:
| Q |
22 |
atgaagaaaaatgatgaaagtctctcctttctttcttaggtactct |
67 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||| |||||||| |
|
|
| T |
29346879 |
atgaagaaaaatgatgaaagtctctcctttctccctttggtactct |
29346834 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 31; Significance: 0.00000002; HSPs: 3)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 19 - 73
Target Start/End: Complemental strand, 17011685 - 17011631
Alignment:
| Q |
19 |
ggtatgaagaaaaatgatgaaagtctctcctttctttcttaggtactctatagta |
73 |
Q |
| |
|
||||||||||||||||||| ||||||||||| ||| ||| |||||||| ||||| |
|
|
| T |
17011685 |
ggtatgaagaaaaatgatgcaagtctctcctctctccctttggtactctctagta |
17011631 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 19 - 73
Target Start/End: Original strand, 17545516 - 17545570
Alignment:
| Q |
19 |
ggtatgaagaaaaatgatgaaagtctctcctttctttcttaggtactctatagta |
73 |
Q |
| |
|
||||||||||||||||||| ||||||||||| ||| ||| |||||||| ||||| |
|
|
| T |
17545516 |
ggtatgaagaaaaatgatgcaagtctctcctctctccctttggtactctctagta |
17545570 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 19 - 112
Target Start/End: Complemental strand, 36316100 - 36316002
Alignment:
| Q |
19 |
ggtatgaagaaaaatgatgaaagtctctcctttctttcttaggtactc-----tatagtaatgatttagtcctagagcttaatcttcttctatcttttc |
112 |
Q |
| |
|
|||| ||||||||||||||||| |||||||| ||| ||| | ||||| || ||||||||||||||| ||| |||||||||||||||| ||||| |
|
|
| T |
36316100 |
ggtaggaagaaaaatgatgaaaatctctcctctctccctttgatactctctagtagagtaatgatttagtcttaggacttaatcttcttctatgttttc |
36316002 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 30; Significance: 0.00000007; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 16 - 49
Target Start/End: Complemental strand, 19261806 - 19261773
Alignment:
| Q |
16 |
aagggtatgaagaaaaatgatgaaagtctctcct |
49 |
Q |
| |
|
||||||||||||||||||||||||||||| |||| |
|
|
| T |
19261806 |
aagggtatgaagaaaaatgatgaaagtctatcct |
19261773 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University