View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF21615_low_35 (Length: 207)

Name: NF21615_low_35
Description: NF21615
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF21615_low_35
NF21615_low_35
[»] chr8 (1 HSPs)
chr8 (98-165)||(4572025-4572092)


Alignment Details
Target: chr8 (Bit Score: 68; Significance: 1e-30; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 68; E-Value: 1e-30
Query Start/End: Original strand, 98 - 165
Target Start/End: Complemental strand, 4572092 - 4572025
Alignment:
98 tcatcactcactcttggttatgctaaagattcatcatttcttaagctctcatcaatgcaagtgatgga 165  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
4572092 tcatcactcactcttggttatgctaaagattcatcatttcttaagctctcatcaatgcaagtgatgga 4572025  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University