View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21617_low_5 (Length: 360)
Name: NF21617_low_5
Description: NF21617
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21617_low_5 |
 |  |
|
| [»] chr2 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 109; Significance: 9e-55; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 109; E-Value: 9e-55
Query Start/End: Original strand, 218 - 360
Target Start/End: Complemental strand, 38515897 - 38515755
Alignment:
| Q |
218 |
gaaagaacgtgatatatgatgatcacataaacttgaataacacttggtttatttttgannnnnnnnnnaataatacccttaatttaaaaaagagaagtaa |
317 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
38515897 |
gaaagaacgtgatatatgatgatcacataaacttgcataacacttggtttatttttgattttttttttaataatacccttaatttaaaaaagagaagtaa |
38515798 |
T |
 |
| Q |
318 |
atccttctctttccatccaaaacccaacttgcaaattaaaacc |
360 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38515797 |
atccttctctttccatccaaaacccaacttgcaaattaaaacc |
38515755 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 94; E-Value: 8e-46
Query Start/End: Original strand, 71 - 168
Target Start/End: Complemental strand, 38516031 - 38515934
Alignment:
| Q |
71 |
ataacatctaaaattatattaaattcgatttcatgactgactatatgaaaatattttataatcaatacgtaacccttaagccttgggtatgtttggag |
168 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
38516031 |
ataacatctaaaattatattaaattcgatttcatgactgactatatgaaaatattttataatcaatacataacccttaagccttgggtatgtttggag |
38515934 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University