View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21619_high_4 (Length: 240)
Name: NF21619_high_4
Description: NF21619
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21619_high_4 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 120; Significance: 2e-61; HSPs: 5)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 120; E-Value: 2e-61
Query Start/End: Original strand, 1 - 147
Target Start/End: Original strand, 1430311 - 1430463
Alignment:
| Q |
1 |
atagtagaattgtgtga-gggtaaattaaagggattgaataccttgagggagat-cttctatcacaatcacttctttcatgtctttttcacaatcgctgt |
98 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1430311 |
atagtagaattgtgtgaagggtaaattaaagggattgaataccttgagggagattcttctatcacaatcacttctttcatgtctttttcacaatcgctgt |
1430410 |
T |
|
| Q |
99 |
aaacaaaatatacgttca----taagatacatacgaattgaaaataaataaaa |
147 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
1430411 |
aaacaaaatatacgttcataattaagatacatacgaattgaaaataaataaaa |
1430463 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 80; E-Value: 1e-37
Query Start/End: Original strand, 142 - 221
Target Start/End: Original strand, 1430688 - 1430767
Alignment:
| Q |
142 |
ataaaattataggaggaaaaagtaaaagggatggagtaccttgtgattggatcagagcaattaaattctcccatcagagg |
221 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1430688 |
ataaaattataggaggaaaaagtaaaagggatggagtaccttgtgattggatcagagcaattaaattctcccatcagagg |
1430767 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 1 - 90
Target Start/End: Complemental strand, 1462816 - 1462726
Alignment:
| Q |
1 |
atagtagaattgtgtgagggtaaattaaagggattgaataccttgagggaga-tcttctatcacaatcacttctttcatgtctttttcaca |
90 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||| |||||| ||| ||||| ||||||||||||||||||||| ||||||||| |
|
|
| T |
1462816 |
atagtagaattgtgtgatggtaaattaaagggattgagtacctttgaatagattcttccatcacaatcacttctttcatgcatttttcaca |
1462726 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #4
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 8 - 37
Target Start/End: Original strand, 1456368 - 1456397
Alignment:
| Q |
8 |
aattgtgtgagggtaaattaaagggattga |
37 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
1456368 |
aattgtgtgagggtaaattaaagggattga |
1456397 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #5
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 8 - 37
Target Start/End: Complemental strand, 1566969 - 1566940
Alignment:
| Q |
8 |
aattgtgtgagggtaaattaaagggattga |
37 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
1566969 |
aattgtgtgagggtaaattaaagggattga |
1566940 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University