View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21619_high_5 (Length: 235)
Name: NF21619_high_5
Description: NF21619
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21619_high_5 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 189; Significance: 1e-102; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 4 - 224
Target Start/End: Complemental strand, 43485784 - 43485569
Alignment:
| Q |
4 |
atcatgattcattaatcatgaataatataaatcatggcattgccttttgaatttgcatcacttttattcacttcatgctatcgaggagaaaggaaggttt |
103 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43485784 |
atcatgattcatgaatcatgaataatataaatcatggcattgccttttgaatt-----cacttttattcacttcatgctatcgaggagaaaggaaggttt |
43485690 |
T |
|
| Q |
104 |
ggatttttaaactttctttttaagttaaattggtacaacaagcaaaaacaaatctcttcatattttttagaagatcaaacatacaagttcttgtaattaa |
203 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
43485689 |
ggatttttaaactttctttttaagttaaattggtacaacaagcaaaaacaaatctcttcatattttttaaaagatcaaacatacaagttcttgtaattaa |
43485590 |
T |
|
| Q |
204 |
gtttataacgtgtgaattcat |
224 |
Q |
| |
|
|||||||| |||||||||||| |
|
|
| T |
43485589 |
gtttataatgtgtgaattcat |
43485569 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University