View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21619_high_8 (Length: 209)
Name: NF21619_high_8
Description: NF21619
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21619_high_8 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 173; Significance: 3e-93; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 173; E-Value: 3e-93
Query Start/End: Original strand, 14 - 194
Target Start/End: Original strand, 48952996 - 48953176
Alignment:
| Q |
14 |
agaaaatgcaagcaacatttatatcctcgcatgtgcttctatcaagcccttcttcgggaaatataatgcgccgaagtacaccattcaattcacatagtaa |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
48952996 |
agaaaatgcaagcaacatttatatcctcgcatgtgcttctatcaagcccttcttcgggaaatataatgcgccgaagtacaccattcaattcacataataa |
48953095 |
T |
 |
| Q |
114 |
caagagttatatctgtgcatcaaaaagagacccatttggccaacaatatgatggcaagttggtggatgagaacatgatcat |
194 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48953096 |
caagagttttatctgtgcatcaaaaagagacccatttggccaacaatatgatggcaagttggtggatgagaacatgatcat |
48953176 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University