View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2161_low_1 (Length: 337)
Name: NF2161_low_1
Description: NF2161
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2161_low_1 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 252; Significance: 1e-140; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 252; E-Value: 1e-140
Query Start/End: Original strand, 21 - 313
Target Start/End: Complemental strand, 15632863 - 15632565
Alignment:
| Q |
21 |
ttaactcggttggaggagctatgtgcatgtccccatgtttctggaatctgtggcattacataaacccaaaccattaccatcataaattagtcaaatattg |
120 |
Q |
| |
|
||||||| | ||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15632863 |
ttaactcagctggaggagctatgtgcatgtccctatgtttctggaatctgtggcattacataaacccaaaccattaccatcataaattagtcaaatattg |
15632764 |
T |
 |
| Q |
121 |
gataaattactagggcaatacaaaccaagctgcatatactgatataccaca------gacaggatgcccgactccgaccaatctccctcccttgctctca |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15632763 |
gataaattactagggcaatacaaaccaagcagcatatactgatataccacagacacagacaggatgcccgactccgaccaatctccctcccttgctctca |
15632664 |
T |
 |
| Q |
215 |
tcgacgcataccctcaaataactccctctcatgctctcctcgtcctcgacaccctcttaatcaagatcttcgatgtctacttctttactgaagcttgta |
313 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
15632663 |
tcgacgcatagcctcaaataactccctctcatgctctcctcgtcctcgacaccctcttaatcaagatcttcgatgtctacttctttactggagcttgta |
15632565 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University