View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2161_low_2 (Length: 306)
Name: NF2161_low_2
Description: NF2161
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2161_low_2 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 230; Significance: 1e-127; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 230; E-Value: 1e-127
Query Start/End: Original strand, 51 - 300
Target Start/End: Complemental strand, 10178461 - 10178212
Alignment:
| Q |
51 |
ccatgtttgattttgaaatgaatggacccttttcgcaagagtggtaaaatgtggggaacaaaagtacaagcaaacttaaaatatatgtatctgatttctt |
150 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |||||||| |
|
|
| T |
10178461 |
ccatgtttgattttgaaatgaatggacccttttcgcaagagtggtaaaatgtggggaacaaaagtacaatcaaacttaaaatatatgtatccgatttctt |
10178362 |
T |
 |
| Q |
151 |
ttggtttgattcaattttgaaaaaggaatctaaaatttgatctcaatgatcagtttcaattcctgtcaattgtcatgcttatatgttattggatttgcta |
250 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
10178361 |
ttggtttgattcaattttgaaaaaggaatctaaaatttgatctcaatgatcaatttcaattcctgtcaattgtcatgcttatatgttgttggatttgcta |
10178262 |
T |
 |
| Q |
251 |
ctagttgctaacctggacttcagaaaatcataataaagttggatgaacaa |
300 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10178261 |
ctagttgctaacatggacttcagaaaatcataataaagttggatgaacaa |
10178212 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 32; Significance: 0.000000007; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 144 - 187
Target Start/End: Complemental strand, 2043064 - 2043021
Alignment:
| Q |
144 |
atttcttttggtttgattcaattttgaaaaaggaatctaaaatt |
187 |
Q |
| |
|
||||| |||||||||||||| |||||||||||||||| |||||| |
|
|
| T |
2043064 |
atttcatttggtttgattcagttttgaaaaaggaatccaaaatt |
2043021 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University