View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21620_high_28 (Length: 243)
Name: NF21620_high_28
Description: NF21620
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21620_high_28 |
 | |
|
| [»] chr7 (1 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 196; Significance: 1e-107; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 196; E-Value: 1e-107
Query Start/End: Original strand, 20 - 243
Target Start/End: Original strand, 32227062 - 32227285
Alignment:
| Q |
20 |
cattaatctcttcttaaccatgtannnnnnnncctgtcatatgcattactacaggtaattcaggcaaagaaagcttgtgatcaagatgagtatatggaag |
119 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32227062 |
cattaatctcttcttaaccatgtattttttttcctgtcatatgcattactacaggtaattcaggcaaagaaagcttgtgatcaagatgagtatatggaag |
32227161 |
T |
|
| Q |
120 |
aagctaatgatacaatcaatcatatcttggtcgatgattatgaggtgaacaaaagttgctttgatgtagcttatcctgcaatgaatgatacaagcatgtc |
219 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32227162 |
aagctaatgatacaatcaatcatatcttcgtcgatgattatgaggtgaacaaaagttgctttgatgtagcttatcctgcaatgaatgatacaagcatgtc |
32227261 |
T |
|
| Q |
220 |
atttatatatgacacaaccatctc |
243 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
32227262 |
atttatatatgacacaaccatctc |
32227285 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University