View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21620_high_30 (Length: 236)
Name: NF21620_high_30
Description: NF21620
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21620_high_30 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 47; Significance: 6e-18; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 95 - 141
Target Start/End: Complemental strand, 5464831 - 5464785
Alignment:
| Q |
95 |
tgttgtatgttggcttttgagaaatgatatttttagtggacttacgc |
141 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5464831 |
tgttgtatgttggcttttgagaaatgatatttttagtggacttacgc |
5464785 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 86 - 140
Target Start/End: Complemental strand, 38235516 - 38235462
Alignment:
| Q |
86 |
gttacactatgttgtatgttggcttttgagaaatgatatttttagtggacttacg |
140 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| || ||||||| |
|
|
| T |
38235516 |
gttacactatgttgtatgttggcttttgagaaatgatatttttaatgcacttacg |
38235462 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University