View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21620_low_34 (Length: 208)
Name: NF21620_low_34
Description: NF21620
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21620_low_34 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 98; Significance: 2e-48; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 98; E-Value: 2e-48
Query Start/End: Original strand, 90 - 191
Target Start/End: Original strand, 53424057 - 53424158
Alignment:
| Q |
90 |
aaagtgagagagatgaactcaaagtgtaaaattggattacattgaaaaccaatcacaaattgaatagttctgattgaatgtgagtgtaaaataactttat |
189 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
53424057 |
aaagtgagagagatgaactcaaagtgtaaaattggattacattgaaaaccaatcacaaattgaatagttctaattgaatgtgagtgtaaaataactttat |
53424156 |
T |
|
| Q |
190 |
at |
191 |
Q |
| |
|
|| |
|
|
| T |
53424157 |
at |
53424158 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 73; E-Value: 2e-33
Query Start/End: Original strand, 12 - 100
Target Start/End: Complemental strand, 53424005 - 53423918
Alignment:
| Q |
12 |
tccctactacacaagctaaactatatttaaagaaaatgtttatttgaaattttgcttttgaatccgagattgaaatcaaaagtgagaga |
100 |
Q |
| |
|
||||||||||||||||||| |||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
53424005 |
tccctactacacaagctaa-ctatatttaaagtaaatgtttatttgaaattttgcttttgaatccgagattgaaatcaacagtgagaga |
53423918 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University