View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21620_low_9 (Length: 434)
Name: NF21620_low_9
Description: NF21620
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21620_low_9 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 91; Significance: 6e-44; HSPs: 4)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 91; E-Value: 6e-44
Query Start/End: Original strand, 321 - 419
Target Start/End: Original strand, 17135806 - 17135904
Alignment:
| Q |
321 |
gcaaaagaataaaattatagatgaattgagtctcaagtaaggttgttaaaatcacgagttaacatgggatcatacgatcctacgagtttaggtatactc |
419 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
17135806 |
gcaaaagaataaaattatagatgaattgagtctcaagtaaggttgttaaaatcacgagttagcatgggatcatacgatcctacgagtctaggtatactc |
17135904 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 75; E-Value: 2e-34
Query Start/End: Original strand, 146 - 224
Target Start/End: Original strand, 17135632 - 17135710
Alignment:
| Q |
146 |
gaggagaaagtgtaggtgtctatgattatgacgtgtcaactcactgctaagagtttttgtcttatggtctgaggggacg |
224 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17135632 |
gaggaaaaagtgtaggtgtctatgattatgacgtgtcaactcactgctaagagtttttgtcttatggtctgaggggacg |
17135710 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 70; E-Value: 2e-31
Query Start/End: Original strand, 19 - 112
Target Start/End: Original strand, 17135505 - 17135598
Alignment:
| Q |
19 |
gaacacttgcaagacattagaatcaatatatagtcagtttgagcattgnnnnnnnnttatatggaaaactatataatcaaaatcaacatcttag |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17135505 |
gaacacttgcaagacattagaatcaatatatagtcagtttgagcattgaaaaaaaattatatggaaaactatataatcaaaatcaacatcttag |
17135598 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #4
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 76 - 108
Target Start/End: Original strand, 17149349 - 17149381
Alignment:
| Q |
76 |
tatatggaaaactatataatcaaaatcaacatc |
108 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
17149349 |
tatatggaaaactatataatcaaaatcaacatc |
17149381 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University