View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21621_high_5 (Length: 316)
Name: NF21621_high_5
Description: NF21621
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21621_high_5 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 257; Significance: 1e-143; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 257; E-Value: 1e-143
Query Start/End: Original strand, 16 - 305
Target Start/End: Original strand, 27927069 - 27927354
Alignment:
| Q |
16 |
aggatttcaaagccaaatcaatttgtcatttttaactttcctaattgaagatttcagtttgaaaagaaatgaattagtgactagtggttgatatctttca |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27927069 |
aggatttcaaagccaaatcaatttgtcatttttaactttcctaattgaagatttcagtttgaaaagaaatgaattagtgactagtggttgatatctttca |
27927168 |
T |
 |
| Q |
116 |
acttatagaaatctatctcttaacaaaatcaaatgtgatttcatgtgtcgatacaaaaataaatgcacattcaattctcagtttgagtgtcctcttgatt |
215 |
Q |
| |
|
|| ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
27927169 |
acatatagaaatctatctcttaacaaaatcaaatgtgatttcatgtgtggatacaaaaataaatgcacattcaattctcagtttgagtgtccacttgata |
27927268 |
T |
 |
| Q |
216 |
tttattgtcgaggatatacttcagatttgtcatgtagacgtacgtagtccacgttttagtacttccaattcattgtgcaattgttttctt |
305 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27927269 |
tttattgtcgaggatatacttcagatttgtcatgtag----acgtagtccacgttttagtacttccaattcattgtgcaattgttttctt |
27927354 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University