View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21621_low_8 (Length: 266)
Name: NF21621_low_8
Description: NF21621
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21621_low_8 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 106; Significance: 4e-53; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 106; E-Value: 4e-53
Query Start/End: Original strand, 124 - 246
Target Start/End: Original strand, 43367317 - 43367443
Alignment:
| Q |
124 |
gcggtgaggtgtgatctagtaatattaccagactcttttttatccgttgattttattttcatcaattagtacacaatcct----tatctaattcaccata |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
43367317 |
gcggtgaggtgtgatctagtaatattaccagactcttttttatccgttgattttattttcatcaattagtacacaatccttatctatctaattcaccata |
43367416 |
T |
|
| Q |
220 |
tctgtcaatcattatcatcttactact |
246 |
Q |
| |
|
|||||||||||| |||||||||||||| |
|
|
| T |
43367417 |
tctgtcaatcatcatcatcttactact |
43367443 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 13 - 56
Target Start/End: Original strand, 43367217 - 43367260
Alignment:
| Q |
13 |
tgagatgaatatgtgttgtagttagaatttccataatgcgtgtg |
56 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43367217 |
tgagatgaatatgtgttgtagttagaatttccataatgcgtgtg |
43367260 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University