View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21622_high_16 (Length: 306)
Name: NF21622_high_16
Description: NF21622
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21622_high_16 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 140; Significance: 2e-73; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 140; E-Value: 2e-73
Query Start/End: Original strand, 13 - 164
Target Start/End: Original strand, 28968024 - 28968175
Alignment:
| Q |
13 |
tgagaatggccacaaaagtcaataattctttgcttggaaacctggtgtgggaactacaaattgcttacggtcgggtgaaagattttaggttccataattt |
112 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
28968024 |
tgagaatggccacaaaagtcaataatactttgcttggaaacctggtgtgggaactacaaattgcttacggtcgggtgaaagattttaggttccatagttt |
28968123 |
T |
 |
| Q |
113 |
ggaacttcattactaaggacggaattattctcagagattcaggtaggagctg |
164 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
28968124 |
ggaacttcattactaaggtcggaattattctcagagattcaggtaggagctg |
28968175 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 252 - 292
Target Start/End: Complemental strand, 29324935 - 29324895
Alignment:
| Q |
252 |
aagtatggatgattgatggatacgtttggtactgataatca |
292 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29324935 |
aagtatggatgattgatggatacgtttggtactgataatca |
29324895 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 68; Significance: 2e-30; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 12 - 163
Target Start/End: Original strand, 29796357 - 29796508
Alignment:
| Q |
12 |
atgagaatggccacaaaagtcaataattctttgcttggaaacctggtgtgggaactacaaattgcttacggtcgggtgaaagattttaggttccataatt |
111 |
Q |
| |
|
||||||||||| ||||||||||||| | || ||||||||||||| | |||||||| ||||| | ||||| ||| |||||||||||| | |||||||| || |
|
|
| T |
29796357 |
atgagaatggctacaaaagtcaatattactatgcttggaaacctagcgtgggaaccacaaactacttactgtcaggtgaaagatttcaagttccatagtt |
29796456 |
T |
 |
| Q |
112 |
tggaacttcattactaaggacggaattattctcagagattcaggtaggagct |
163 |
Q |
| |
|
|||||||| ||||||||| | ||||||||||||||||| |||||||||| |
|
|
| T |
29796457 |
tggaactttgttactaaggccaagattattctcagagattccggtaggagct |
29796508 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 53; Significance: 2e-21; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 13 - 164
Target Start/End: Complemental strand, 34082685 - 34082533
Alignment:
| Q |
13 |
tgagaatggccacaaaagtcaataattctttgcttggaaacctggtgtgggaactacaaattgcttacggtcg-ggtgaaagattttaggttccataatt |
111 |
Q |
| |
|
|||||||| | ||||||||||| | | || |||||||||||||||||||||||| ||||| | ||||| ||| ||| ||||||| |||||||||| || |
|
|
| T |
34082685 |
tgagaatgactacaaaagtcaacattactatgcttggaaacctggtgtgggaaccacaaactacttactgtcaaggtataagatttcaggttccatagtt |
34082586 |
T |
 |
| Q |
112 |
tggaacttcattactaaggacggaattattctcagagattcaggtaggagctg |
164 |
Q |
| |
|
|||||||| ||||||||| | ||||||||||||||||| ||| ||||||| |
|
|
| T |
34082585 |
tggaactttgttactaaggccaagattattctcagagattccggtgggagctg |
34082533 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University