View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21622_low_16 (Length: 309)
Name: NF21622_low_16
Description: NF21622
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21622_low_16 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 187; Significance: 1e-101; HSPs: 3)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 1 - 199
Target Start/End: Complemental strand, 14433486 - 14433288
Alignment:
| Q |
1 |
gaaggttaactaacaatgtgtttaattttattttgtaggaatacaaaaatgcaattaatatattgcattcaaggatgtttcaatggggtggtgatgttgc |
100 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
14433486 |
gaaggttaactaacaatgcgtttaattttattttgtaggaatacaaaaatgcaattaatatattgcattcaaggatgtttcaatggggtggtgatgctgc |
14433387 |
T |
|
| Q |
101 |
tgtgtatgataaaaatgaatcttacatagaggtggtgacctccccaaacaaccctgatggaacccttcgtgtaccagtggtgaactctgcagctaaagg |
199 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14433386 |
tgtgtatgataaaaatgaatcttacatagaggtggtgacttccccaaacaaccctgatggaacccttcgtgtaccagtggtgaactctgcagctaaagg |
14433288 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 100; E-Value: 2e-49
Query Start/End: Original strand, 193 - 296
Target Start/End: Original strand, 14433654 - 14433757
Alignment:
| Q |
193 |
ctaaaggagacaaagcaaacaaagcagcttggaagagttgagaagagccatttccaacaactatgtatttatctttggtcacagcatttccaactaaatg |
292 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14433654 |
ctaaaggagacaaagcgaacaaagcagcttggaagagttgagaagagccatttccaacaactatgtatttatctttggtcacagcatttccaactaaatg |
14433753 |
T |
|
| Q |
293 |
atga |
296 |
Q |
| |
|
|||| |
|
|
| T |
14433754 |
atga |
14433757 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 27 - 187
Target Start/End: Complemental strand, 14441791 - 14441631
Alignment:
| Q |
27 |
tttattttgtaggaatacaaaaatgcaattaat-atattgcattcaaggatgtttcaatggggtggtgatgttgctgtgtatgataaaaatgaatcttac |
125 |
Q |
| |
|
|||||||||||||||||| || ||| ||| || ||| |||| |||||| | ||||||||||||||||||| |||| |||||||| |||| || ||||| |
|
|
| T |
14441791 |
tttattttgtaggaataccaagatgtgattgatcata-tgcaatcaaggctatttcaatggggtggtgatgctgctttgtatgatgaaaacaaaccttac |
14441693 |
T |
|
| Q |
126 |
atagaggtggtgacctccccaaacaaccctgatggaacccttcgtgtaccagtggtgaactc |
187 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||| || ||||| ||||||||||||||| |
|
|
| T |
14441692 |
atagaggtagtgacctccccaaacaaccctgatgggactcttcgaacaccagtggtgaactc |
14441631 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University