View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21622_low_18 (Length: 305)
Name: NF21622_low_18
Description: NF21622
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21622_low_18 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 141; Significance: 6e-74; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 141; E-Value: 6e-74
Query Start/End: Original strand, 145 - 301
Target Start/End: Original strand, 33035340 - 33035496
Alignment:
| Q |
145 |
aagaaagctaactagtagtaacaagtaaaaactactttttaacacttcctaagttcaatctacaattggatttattgtagatagtatatggaagaaccaa |
244 |
Q |
| |
|
||||||| |||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33035340 |
aagaaagttaactagtagtaacaagtaacaactactttttaacacttcctaagttcaatctacaattggatttattgtagatagtatatggaagaaccaa |
33035439 |
T |
 |
| Q |
245 |
aattaaacaaacaagagtgtgtgcactgtgtggtcattattcccacctatgcttctc |
301 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| ||| ||||| |
|
|
| T |
33035440 |
aattaaacaaacaagagtgtgtgcactgtgtggtcattattcccaccaatgattctc |
33035496 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 52; E-Value: 8e-21
Query Start/End: Original strand, 53 - 108
Target Start/End: Original strand, 33035248 - 33035303
Alignment:
| Q |
53 |
taagagctccactctactaatgagattaatttgttgtaaatacaagatataatatg |
108 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33035248 |
taagatctccactctactaatgagattaatttgttgtaaatacaagatataatatg |
33035303 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University